Transcript: Human XM_011527202.1

PREDICTED: Homo sapiens testis specific serine kinase substrate (TSKS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSKS (60385)
Length:
1919
CDS:
82..1824

Additional Resources:

NCBI RefSeq record:
XM_011527202.1
NBCI Gene record:
TSKS (60385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418105 CAATTTCAGAACTCTCGAAGA pLKO_005 1360 CDS 100% 4.050 5.670 N TSKS n/a
2 TRCN0000037651 TGACGCAGACATCACGGAAAT pLKO.1 456 CDS 100% 10.800 7.560 N TSKS n/a
3 TRCN0000037652 CAGAGGCTACACAAGAAGATT pLKO.1 1555 CDS 100% 5.625 3.938 N TSKS n/a
4 TRCN0000037650 GAAACCCATTCTGGAGGAGTT pLKO.1 1332 CDS 100% 4.050 2.835 N TSKS n/a
5 TRCN0000037653 GCAGTCCAAAGAGATCCATGA pLKO.1 111 CDS 100% 4.050 2.835 N TSKS n/a
6 TRCN0000417683 GGGTACTGCATTCAACTCAAG pLKO_005 640 CDS 100% 4.050 2.835 N TSKS n/a
7 TRCN0000037649 CCAACGTCTTGAAGCAGAATT pLKO.1 710 CDS 100% 0.000 0.000 N TSKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10464 pDONR223 100% 93.7% 82.3% None 1497_1539del;1740_1741ins70 n/a
2 ccsbBroad304_10464 pLX_304 0% 93.7% 82.3% V5 1497_1539del;1740_1741ins70 n/a
3 TRCN0000476596 GACACATATGAGACCCCTAACGCC pLX_317 14.7% 93.7% 82.3% V5 1497_1539del;1740_1741ins70 n/a
Download CSV