Transcript: Human XM_011527241.2

PREDICTED: Homo sapiens small nuclear ribonucleoprotein U1 subunit 70 (SNRNP70), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNRNP70 (6625)
Length:
1170
CDS:
639..1007

Additional Resources:

NCBI RefSeq record:
XM_011527241.2
NBCI Gene record:
SNRNP70 (6625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000011 CCAAGGGTAGGTGTCTCATTT pLKO.1 1104 3UTR 100% 13.200 9.240 N SNRNP70 n/a
2 TRCN0000272735 CCAAGGGTAGGTGTCTCATTT pLKO_005 1104 3UTR 100% 13.200 9.240 N SNRNP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06982 pDONR223 100% 27.9% 27.9% None 0_1ins945 n/a
2 ccsbBroad304_06982 pLX_304 0% 27.9% 27.9% V5 0_1ins945 n/a
3 TRCN0000480471 CTCGCGGACACAGTTATGTTCTCA pLX_317 27.3% 27.9% 27.9% V5 0_1ins945 n/a
Download CSV