Transcript: Human XM_011527479.1

PREDICTED: Homo sapiens NLR family pyrin domain containing 12 (NLRP12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLRP12 (91662)
Length:
3553
CDS:
230..3247

Additional Resources:

NCBI RefSeq record:
XM_011527479.1
NBCI Gene record:
NLRP12 (91662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107108 CGACCTTTACCTGACCAACAA pLKO.1 3064 CDS 100% 4.950 6.930 N NLRP12 n/a
2 TRCN0000107106 GCTCTCATAGCCAATAAGAAT pLKO.1 2525 CDS 100% 5.625 3.938 N NLRP12 n/a
3 TRCN0000107109 GAAGGAATACTTCTACAAGTA pLKO.1 1339 CDS 100% 0.495 0.347 N NLRP12 n/a
4 TRCN0000107107 CCACTTGAGTTTCCAGGAATT pLKO.1 1768 CDS 100% 0.000 0.000 N NLRP12 n/a
5 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 3475 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09321 pDONR223 100% 94.5% 94.5% None 2073_2075delCAG;2417_2418ins171 n/a
2 ccsbBroad304_09321 pLX_304 0% 94.5% 94.5% V5 2073_2075delCAG;2417_2418ins171 n/a
Download CSV