Transcript: Human XM_011527699.2

PREDICTED: Homo sapiens zinc finger protein 563 (ZNF563), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF563 (147837)
Length:
1766
CDS:
354..1673

Additional Resources:

NCBI RefSeq record:
XM_011527699.2
NBCI Gene record:
ZNF563 (147837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015688 CGTCCCAGTTTAGTTCGATAT pLKO.1 1284 CDS 100% 10.800 15.120 N ZNF563 n/a
2 TRCN0000015691 CGCTGAGTGTGAAGAAGTCAT pLKO.1 557 CDS 100% 4.950 3.465 N ZNF563 n/a
3 TRCN0000015690 TGGAGAAACATTTAGCCTCAT pLKO.1 482 CDS 100% 4.050 2.835 N ZNF563 n/a
4 TRCN0000015689 GCAAGGTGGAAATAGACCTTA pLKO.1 812 CDS 100% 0.495 0.347 N ZNF563 n/a
5 TRCN0000015692 CCTTTGTTTATCCCAGTGTAT pLKO.1 1612 CDS 100% 4.950 2.475 Y ZNF563 n/a
6 TRCN0000235191 ACTGGAGAGAAACCATATAAA pLKO_005 1068 CDS 100% 15.000 7.500 Y Gm4767 n/a
7 TRCN0000235210 ACTGGAGAGAAACCATATAAA pLKO_005 1068 CDS 100% 15.000 7.500 Y EG666477 n/a
8 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1322 CDS 100% 13.200 6.600 Y Zfp977 n/a
9 TRCN0000107953 GCTGTGAACTTCACCCAGGAA pLKO.1 331 5UTR 100% 2.640 1.320 Y ZNF799 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05002 pDONR223 100% 92.2% 86.3% None 0_1ins50;80_81ins61 n/a
2 ccsbBroad304_05002 pLX_304 0% 92.2% 86.3% V5 0_1ins50;80_81ins61 n/a
3 TRCN0000481100 ACGCTTAGGCTAATGTCCTTGTGC pLX_317 27.2% 92.2% 86.3% V5 0_1ins50;80_81ins61 n/a
Download CSV