Transcript: Human XM_011527991.2

PREDICTED: Homo sapiens Janus kinase 3 (JAK3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JAK3 (3718)
Length:
3237
CDS:
11..1963

Additional Resources:

NCBI RefSeq record:
XM_011527991.2
NBCI Gene record:
JAK3 (3718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000384 CCAGGACAGACAACCAGATTT pLKO.1 1101 CDS 100% 13.200 9.240 N JAK3 n/a
2 TRCN0000000387 CAGCGCCTATCTTTCTCCTTT pLKO.1 254 CDS 100% 4.950 3.465 N JAK3 n/a
3 TRCN0000199358 CTCATGGCCAAGTACATCATG pLKO.1 839 CDS 100% 4.950 3.465 N JAK3 n/a
4 TRCN0000194760 CATAGACATGTATCTGCGAAA pLKO.1 2863 3UTR 100% 4.050 2.835 N JAK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14681 pDONR223 0% 51.6% 51.2% None (many diffs) n/a
2 ccsbBroad304_14681 pLX_304 0% 51.6% 51.2% V5 (many diffs) n/a
3 TRCN0000479534 ATCTACGCTAGAGACGCTCTGGCC pLX_317 9.3% 51.6% 51.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000465342 CTCCTTCTTTCGTAAAACACAACA pLX_317 5.7% 51.6% 51.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488408 GAGTGCTGAAGTGTGACTTTCTCC pLX_317 8.7% 51.6% 51.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488116 GGAACCGAGAATTTTTTAAATAAA pLX_317 7.1% 51.5% 51.1% V5 (many diffs) n/a
Download CSV