Transcript: Human XM_011528018.1

PREDICTED: Homo sapiens megakaryocyte-associated tyrosine kinase (MATK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MATK (4145)
Length:
2289
CDS:
556..2079

Additional Resources:

NCBI RefSeq record:
XM_011528018.1
NBCI Gene record:
MATK (4145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237851 TGGTGAGACCAAAGCGGAAAC pLKO_005 1175 CDS 100% 6.000 8.400 N MATK n/a
2 TRCN0000355857 CAATCGATGAGGCCGTGTTCT pLKO_005 1091 CDS 100% 4.950 6.930 N MATK n/a
3 TRCN0000378189 TACGTCCTGTGCGTGAGCTTT pLKO_005 1021 CDS 100% 4.950 6.930 N MATK n/a
4 TRCN0000002220 GACGAAGATGCAACACGAGAA pLKO.1 1395 CDS 100% 4.050 5.670 N MATK n/a
5 TRCN0000199107 CAAGAGCTGGTACCGCGTCAA pLKO.1 804 CDS 100% 0.000 0.000 N MATK n/a
6 TRCN0000002221 CAAGTCGGATGTCTGGAGTTT pLKO.1 1764 CDS 100% 4.950 3.960 N MATK n/a
7 TRCN0000244304 AGGGCAACCTGGTGAACTTTC pLKO_005 1481 CDS 100% 10.800 7.560 N MATK n/a
8 TRCN0000237850 CATGGACATGGTGGAGCATTA pLKO_005 1122 CDS 100% 10.800 7.560 N MATK n/a
9 TRCN0000237849 TTACTGAACCTGCAGCATTTG pLKO_005 1240 CDS 100% 10.800 7.560 N MATK n/a
10 TRCN0000355858 GGCTCTCAAACACGGGAAGTT pLKO_005 1737 CDS 100% 4.950 3.465 N MATK n/a
11 TRCN0000002223 CTTCTGCAACCTCATGGACAT pLKO.1 1110 CDS 100% 4.050 2.835 N MATK n/a
12 TRCN0000002219 GCATTTGACATTGGGAGCACA pLKO.1 1254 CDS 100% 2.640 1.848 N MATK n/a
13 TRCN0000199564 GCCCGCAACATCCTGGTCTCA pLKO.1 1618 CDS 100% 0.000 0.000 N MATK n/a
14 TRCN0000237852 CACCCAGTGTATCACCAAATG pLKO_005 705 CDS 100% 10.800 6.480 N MATK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14694 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14694 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471647 TCGGTCCAATATTTAGTTCTGCTT pLX_317 28.4% 100% 100% V5 n/a
4 TRCN0000489618 TACACCTGACTTTACCGGCATTTC pLX_317 27.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489779 GCCGATCGCGCTTCGCGCGTGTAC pLX_317 26.7% 100% 100% V5 (not translated due to prior stop codon) n/a
6 TRCN0000488126 GATCCGACTCTAGGCGACTATCGT pLX_317 20% 99.9% 99.8% V5 1521_1522insG n/a
Download CSV