Transcript: Human XM_011528210.2

PREDICTED: Homo sapiens syntaxin binding protein 2 (STXBP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP2 (6813)
Length:
1877
CDS:
39..1832

Additional Resources:

NCBI RefSeq record:
XM_011528210.2
NBCI Gene record:
STXBP2 (6813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231118 AGAAGGAGCTGAATAAGTATT pLKO_005 1048 CDS 100% 13.200 18.480 N STXBP2 n/a
2 TRCN0000065034 CGGAGTTATTCGGAGTGTCAA pLKO.1 86 CDS 100% 4.950 6.930 N STXBP2 n/a
3 TRCN0000065036 CTCTACATCCTCCTTCGGAAT pLKO.1 1263 CDS 100% 4.050 5.670 N STXBP2 n/a
4 TRCN0000231117 GGAGCTTCGCCACATGCATAT pLKO_005 905 CDS 100% 10.800 8.640 N STXBP2 n/a
5 TRCN0000231115 CCCAGTCTGGAGGCCATTTAT pLKO_005 243 CDS 100% 15.000 10.500 N STXBP2 n/a
6 TRCN0000218519 CATCTAGCAGATGATTGTATG pLKO_005 1080 CDS 100% 10.800 7.560 N STXBP2 n/a
7 TRCN0000231116 CGTATGATCTGCTGGACATAG pLKO_005 796 CDS 100% 10.800 7.560 N STXBP2 n/a
8 TRCN0000065037 CATCACCATTGTTGAAGACAT pLKO.1 200 CDS 100% 4.950 3.465 N STXBP2 n/a
9 TRCN0000065033 GCGTATGATCTGCTGGACATA pLKO.1 795 CDS 100% 4.950 3.465 N STXBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13961 pDONR223 100% 77.4% 75.8% None (many diffs) n/a
2 ccsbBroad304_13961 pLX_304 0% 77.4% 75.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV