Transcript: Human XM_011528371.2

PREDICTED: Homo sapiens zinc finger protein 333 (ZNF333), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF333 (84449)
Length:
6563
CDS:
1109..2539

Additional Resources:

NCBI RefSeq record:
XM_011528371.2
NBCI Gene record:
ZNF333 (84449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016219 GCGTTGTCTTATTTGGAAGAA pLKO.1 1292 CDS 100% 4.950 6.930 N ZNF333 n/a
2 TRCN0000016222 GAGTCGTCTTTCAACCCTGAA pLKO.1 2170 CDS 100% 4.050 5.670 N ZNF333 n/a
3 TRCN0000016218 CGAGGAACTTTAACCTGATTT pLKO.1 1836 CDS 100% 13.200 10.560 N ZNF333 n/a
4 TRCN0000432674 TAACCTCCATTATCGTTTATT pLKO_005 2661 3UTR 100% 15.000 10.500 N ZNF333 n/a
5 TRCN0000016220 CCTGTGAATGTCAAGAGATTA pLKO.1 1551 CDS 100% 13.200 9.240 N ZNF333 n/a
6 TRCN0000426243 TCCAGAGTGCCCACCTAATTG pLKO_005 1584 CDS 100% 13.200 9.240 N ZNF333 n/a
7 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1880 CDS 100% 13.200 6.600 Y LOC676710 n/a
8 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1880 CDS 100% 10.800 5.400 Y Zfp647 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 428 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 428 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12819 pDONR223 100% 17% 16.6% None (many diffs) n/a
2 ccsbBroad304_12819 pLX_304 0% 17% 16.6% V5 (many diffs) n/a
3 TRCN0000466420 GCAATCTAATCTTAACTCCGACAA pLX_317 37.4% 17% 16.6% V5 (many diffs) n/a
Download CSV