Transcript: Human XM_011528396.2

PREDICTED: Homo sapiens phospholipid phosphatase 2 (PLPP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLPP2 (8612)
Length:
1307
CDS:
78..962

Additional Resources:

NCBI RefSeq record:
XM_011528396.2
NBCI Gene record:
PLPP2 (8612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002582 GCTCTATTCTCGCTCGGACTT pLKO.1 338 CDS 100% 4.050 5.670 N PLPP2 n/a
2 TRCN0000381716 CAACTACGTGGCTGCTGTATA pLKO_005 362 CDS 100% 13.200 10.560 N PLPP2 n/a
3 TRCN0000350421 TGTACACAGACCGGCTCTATT pLKO_005 325 CDS 100% 13.200 9.240 N PLPP2 n/a
4 TRCN0000379701 ACATCTCAGACTTCTTCAAAG pLKO_005 820 CDS 100% 10.800 7.560 N PLPP2 n/a
5 TRCN0000336161 ACCTGGCCAAGTACATGATTG pLKO_005 436 CDS 100% 10.800 7.560 N Plpp2 n/a
6 TRCN0000381061 ACCTGGCCAAGTACATGATTG pLKO_005 436 CDS 100% 10.800 7.560 N PLPP2 n/a
7 TRCN0000002584 GAAGGGACCGAGAGATCAGAT pLKO.1 1221 3UTR 100% 4.950 3.465 N PLPP2 n/a
8 TRCN0000315259 GAAGGGACCGAGAGATCAGAT pLKO_005 1221 3UTR 100% 4.950 3.465 N PLPP2 n/a
9 TRCN0000002583 GAGGCTGACCACAACCACTAT pLKO.1 918 CDS 100% 4.950 3.465 N PLPP2 n/a
10 TRCN0000315190 GAGGCTGACCACAACCACTAT pLKO_005 918 CDS 100% 4.950 3.465 N PLPP2 n/a
11 TRCN0000002585 CGGGTCAACTGCTCGGTCTAT pLKO.1 504 CDS 100% 1.650 1.155 N PLPP2 n/a
12 TRCN0000002581 CGCTATCCTGACGCTGGTGAA pLKO.1 161 CDS 100% 1.350 0.945 N PLPP2 n/a
13 TRCN0000315189 CGCTATCCTGACGCTGGTGAA pLKO_005 161 CDS 100% 1.350 0.945 N PLPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01968 pDONR223 100% 97.9% 97.9% None 52_69del n/a
2 ccsbBroad304_01968 pLX_304 0% 97.9% 97.9% V5 52_69del n/a
3 TRCN0000473645 TCGAACAACATATAAACTGATGAT pLX_317 6.5% 97.8% 93.5% V5 (not translated due to prior stop codon) 52_69del;842_843insG n/a
Download CSV