Transcript: Human XM_011528737.1

PREDICTED: Homo sapiens solute carrier family 9 member A8 (SLC9A8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A8 (23315)
Length:
6144
CDS:
30..1838

Additional Resources:

NCBI RefSeq record:
XM_011528737.1
NBCI Gene record:
SLC9A8 (23315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043783 CCGATACAGATTACATTTCTT pLKO.1 269 CDS 100% 5.625 7.875 N SLC9A8 n/a
2 TRCN0000043785 CCGTGGCCTTCTTATGTGAAA pLKO.1 1150 CDS 100% 4.950 6.930 N SLC9A8 n/a
3 TRCN0000432915 GTAGTAGGTGGAGGAATTTAT pLKO_005 447 CDS 100% 15.000 12.000 N SLC9A8 n/a
4 TRCN0000043784 GCACTCTCACTGGCTTAATTT pLKO.1 916 CDS 100% 15.000 10.500 N SLC9A8 n/a
5 TRCN0000043787 CCTAGCTATCTGCATCATATT pLKO.1 233 CDS 100% 13.200 9.240 N SLC9A8 n/a
6 TRCN0000430472 GCATTAGTGCTGAAGCATATT pLKO_005 939 CDS 100% 13.200 9.240 N SLC9A8 n/a
7 TRCN0000043786 GTGCTCAACATGCTGGTCTTT pLKO.1 642 CDS 100% 4.950 3.465 N SLC9A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07866 pDONR223 100% 87.6% 87.6% None (many diffs) n/a
2 ccsbBroad304_07866 pLX_304 0% 87.6% 87.6% V5 (many diffs) n/a
3 TRCN0000478106 TGATCCCTTCCATCACCAATCCGC pLX_317 15.4% 87.6% 87.6% V5 (many diffs) n/a
Download CSV