Transcript: Human XM_011528743.2

PREDICTED: Homo sapiens solute carrier family 9 member A8 (SLC9A8), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A8 (23315)
Length:
5408
CDS:
98..1102

Additional Resources:

NCBI RefSeq record:
XM_011528743.2
NBCI Gene record:
SLC9A8 (23315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043785 CCGTGGCCTTCTTATGTGAAA pLKO.1 414 CDS 100% 4.950 6.930 N SLC9A8 n/a
2 TRCN0000043784 GCACTCTCACTGGCTTAATTT pLKO.1 180 CDS 100% 15.000 10.500 N SLC9A8 n/a
3 TRCN0000430472 GCATTAGTGCTGAAGCATATT pLKO_005 203 CDS 100% 13.200 9.240 N SLC9A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07866 pDONR223 100% 57.4% 57.4% None 0_1ins741;234T>G n/a
2 ccsbBroad304_07866 pLX_304 0% 57.4% 57.4% V5 0_1ins741;234T>G n/a
3 TRCN0000478106 TGATCCCTTCCATCACCAATCCGC pLX_317 15.4% 57.4% 57.4% V5 0_1ins741;234T>G n/a
Download CSV