Transcript: Human XM_011528843.2

PREDICTED: Homo sapiens PHD finger protein 20 (PHF20), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF20 (51230)
Length:
5498
CDS:
924..2753

Additional Resources:

NCBI RefSeq record:
XM_011528843.2
NBCI Gene record:
PHF20 (51230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016313 CCCGAGAAATACACCTGTTAT pLKO.1 1779 CDS 100% 13.200 18.480 N PHF20 n/a
2 TRCN0000379949 AGCGTTGGAACCATCGTTATG pLKO_005 245 5UTR 100% 10.800 15.120 N PHF20 n/a
3 TRCN0000379882 AGCATTGGAGGAGGATAATTT pLKO_005 1532 CDS 100% 15.000 10.500 N PHF20 n/a
4 TRCN0000016316 GCATGGGATTACTGGAAGAAA pLKO.1 1753 CDS 100% 5.625 3.938 N PHF20 n/a
5 TRCN0000016315 CCAGCTCACATAGAAGACATT pLKO.1 190 5UTR 100% 4.950 3.465 N PHF20 n/a
6 TRCN0000016317 CCTGACTTGGTTGTATCAGAT pLKO.1 738 5UTR 100% 4.950 3.465 N PHF20 n/a
7 TRCN0000380621 ATTGTGCCACTGATGATAAAC pLKO_005 3040 3UTR 100% 13.200 7.920 N PHF20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08258 pDONR223 100% 60.1% 60% None 0_1ins1209;604G>A n/a
2 ccsbBroad304_08258 pLX_304 0% 60.1% 60% V5 0_1ins1209;604G>A n/a
3 TRCN0000481434 CCCTCCTTGTTAAAGCGGCATCAG pLX_317 14.2% 60.1% 60% V5 0_1ins1209;604G>A n/a
Download CSV