Transcript: Human XM_011528907.1

PREDICTED: Homo sapiens acyl-CoA synthetase short chain family member 2 (ACSS2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSS2 (55902)
Length:
2997
CDS:
75..2249

Additional Resources:

NCBI RefSeq record:
XM_011528907.1
NBCI Gene record:
ACSS2 (55902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076125 GATCGAAATGTCCATGAGAAA pLKO.1 399 CDS 100% 4.950 6.930 N Acss2 n/a
2 TRCN0000045567 CGAACGCTTTGAGACAACCTA pLKO.1 1742 CDS 100% 3.000 4.200 N ACSS2 n/a
3 TRCN0000045566 GCTACAATGTACTGGATCGAA pLKO.1 385 CDS 100% 3.000 4.200 N ACSS2 n/a
4 TRCN0000045565 CGGTTCTGCTACTTTCCCATT pLKO.1 1571 CDS 100% 4.050 3.240 N ACSS2 n/a
5 TRCN0000076126 GTGTGTCAGTTCAGCAATGTT pLKO.1 546 CDS 100% 5.625 3.938 N Acss2 n/a
6 TRCN0000045564 GCTTGGAGATAAAGTTGCTTT pLKO.1 422 CDS 100% 4.950 3.465 N ACSS2 n/a
7 TRCN0000045563 GCTTCTGTTCTGGGTCTGAAT pLKO.1 2698 3UTR 100% 4.950 2.970 N ACSS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12288 pDONR223 100% 61% 61% None 1_816del;1587_1616del n/a
2 ccsbBroad304_12288 pLX_304 0% 61% 61% V5 1_816del;1587_1616del n/a
3 TRCN0000471769 ATGACCTACGCTCGGTAGGCACAC pLX_317 34.3% 61% 61% V5 1_816del;1587_1616del n/a
Download CSV