Transcript: Human XM_011528937.1

PREDICTED: Homo sapiens collagen type XX alpha 1 chain (COL20A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL20A1 (57642)
Length:
7769
CDS:
118..4407

Additional Resources:

NCBI RefSeq record:
XM_011528937.1
NBCI Gene record:
COL20A1 (57642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116862 CCCTCAAGTATCTGATCGTTT pLKO.1 1331 CDS 100% 4.950 6.930 N COL20A1 n/a
2 TRCN0000116863 CGTGTCAAAGTTCGACTCCTT pLKO.1 3788 CDS 100% 2.640 3.696 N COL20A1 n/a
3 TRCN0000116864 CCCGACCTTCACGCTCTTCAA pLKO.1 2739 CDS 100% 1.650 1.320 N COL20A1 n/a
4 TRCN0000116865 CCGCAGGAAGTGAGGAAGATT pLKO.1 2998 CDS 100% 5.625 3.938 N COL20A1 n/a
5 TRCN0000116866 GCTCCATTACTGGCTCACCTA pLKO.1 2424 CDS 100% 2.640 1.848 N COL20A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12382 pDONR223 100% 44.5% 42.5% None 1281A>G;1804_1807delCAGA;1916_4287del n/a
2 ccsbBroad304_12382 pLX_304 0% 44.5% 42.5% V5 1281A>G;1804_1807delCAGA;1916_4287del n/a
3 TRCN0000465395 CCCGTTATTTACTGAGACAACGAC pLX_317 11.6% 44.5% 42.5% V5 1281A>G;1804_1807delCAGA;1916_4287del n/a
4 ccsbBroadEn_12381 pDONR223 100% 9.1% 5.9% None 1_3507del;3666_3667ins67;3906_4287del n/a
5 ccsbBroad304_12381 pLX_304 0% 9.1% 5.9% V5 1_3507del;3666_3667ins67;3906_4287del n/a
6 TRCN0000466498 CCGACGGTGTTTCAAGTGTTGATG pLX_317 73.6% 9.1% 5.9% V5 1_3507del;3666_3667ins67;3906_4287del n/a
Download CSV