Transcript: Human XM_011529034.3

PREDICTED: Homo sapiens TPD52 like 2 (TPD52L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPD52L2 (7165)
Length:
1161
CDS:
120..749

Additional Resources:

NCBI RefSeq record:
XM_011529034.3
NBCI Gene record:
TPD52L2 (7165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160809 CTCTACAAGAAGACTCAGGAA pLKO.1 492 CDS 100% 2.640 1.848 N TPD52L2 n/a
2 TRCN0000166346 CTTACCAAGGTGGAAGAGGAA pLKO.1 276 CDS 100% 2.640 1.848 N TPD52L2 n/a
3 TRCN0000165132 GTGGAATGAGAAAGTGACCCA pLKO.1 464 CDS 100% 0.660 0.462 N TPD52L2 n/a
4 TRCN0000162138 CTTGGAGAGTGGAATGAGAAA pLKO.1 456 CDS 100% 4.950 2.970 N TPD52L2 n/a
5 TRCN0000166528 CAGGAAACTCTTTCACAGGCA pLKO.1 507 CDS 100% 0.660 0.396 N TPD52L2 n/a
6 TRCN0000280925 CAGGAAACTCTTTCACAGGCA pLKO_005 507 CDS 100% 0.660 0.396 N TPD52L2 n/a
7 TRCN0000087990 GACCTCTACAAGAAGACTCAA pLKO.1 489 CDS 100% 4.950 3.465 N Tpd52l2 n/a
8 TRCN0000312145 GACCTCTACAAGAAGACTCAA pLKO_005 489 CDS 100% 4.950 3.465 N Tpd52l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01699 pDONR223 100% 80% 74.5% None (many diffs) n/a
2 ccsbBroad304_01699 pLX_304 0% 80% 74.5% V5 (many diffs) n/a
3 TRCN0000473459 ACACTAGGGGAACCTCTCCGGAAC pLX_317 79.9% 80% 74.5% V5 (many diffs) n/a
Download CSV