Transcript: Human XM_011529095.2

PREDICTED: Homo sapiens sorting nexin family member 21 (SNX21), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX21 (90203)
Length:
2749
CDS:
513..1190

Additional Resources:

NCBI RefSeq record:
XM_011529095.2
NBCI Gene record:
SNX21 (90203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073334 CCAGTCTCAAAGAATTGCTCA pLKO.1 1150 CDS 100% 2.640 2.112 N SNX21 n/a
2 TRCN0000073333 CCTCACTTCAAGGTTATCAAT pLKO.1 2655 3UTR 100% 5.625 3.938 N SNX21 n/a
3 TRCN0000381781 GGCCTGGACAAACGTCAATCA pLKO_005 1077 CDS 100% 4.950 3.465 N SNX21 n/a
4 TRCN0000382414 TTTACTGCAGAGACCATTGCC pLKO_005 678 CDS 100% 2.640 1.848 N SNX21 n/a
5 TRCN0000380634 GACAAGAGCCTCCACCCTTTG pLKO_005 1011 CDS 100% 2.000 1.400 N SNX21 n/a
6 TRCN0000073337 CCTCACCTGTACTGGCCTCTA pLKO.1 815 CDS 100% 1.350 0.945 N SNX21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09290 pDONR223 100% 12.9% 12.3% None (many diffs) n/a
2 ccsbBroad304_09290 pLX_304 0% 12.9% 12.3% V5 (many diffs) n/a
3 TRCN0000466796 CTTACAATAACTAAGCAGCCCCCG pLX_317 69.2% 12.9% 12.3% V5 (many diffs) n/a
Download CSV