Transcript: Human XM_011529141.1

PREDICTED: Homo sapiens RNA polymerase III subunit F (POLR3F), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLR3F (10621)
Length:
2215
CDS:
431..1129

Additional Resources:

NCBI RefSeq record:
XM_011529141.1
NBCI Gene record:
POLR3F (10621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418655 ATGCCAACATACCCGTATTTA pLKO_005 1427 3UTR 100% 15.000 21.000 N POLR3F n/a
2 TRCN0000425651 GAAGGTGTATATGCTCTATAA pLKO_005 619 CDS 100% 13.200 18.480 N POLR3F n/a
3 TRCN0000421447 TGCGAATTGGGAATCAGTAAG pLKO_005 839 CDS 100% 10.800 15.120 N POLR3F n/a
4 TRCN0000052961 GATGACGATTATTGCTGCAAA pLKO.1 925 CDS 100% 4.950 6.930 N POLR3F n/a
5 TRCN0000418497 GGGTCAGTTGGATCTCTTAAG pLKO_005 358 5UTR 100% 10.800 8.640 N POLR3F n/a
6 TRCN0000052960 CCATCAATAGGTTGTTGTCTA pLKO.1 274 5UTR 100% 4.950 3.960 N POLR3F n/a
7 TRCN0000052958 CCATCCTGAATACACTCATTT pLKO.1 888 CDS 100% 13.200 9.240 N POLR3F n/a
8 TRCN0000052962 TCAGAATGAAATGCCTCATAT pLKO.1 230 5UTR 100% 13.200 9.240 N POLR3F n/a
9 TRCN0000423339 GTGTAGATGGACACATGAAAC pLKO_005 963 CDS 100% 10.800 7.560 N POLR3F n/a
10 TRCN0000417536 AGGGATCCGATAACCAAGAAA pLKO_005 435 CDS 100% 5.625 3.938 N POLR3F n/a
11 TRCN0000052959 CTGAATTTGTAGAGGTGCTTA pLKO.1 699 CDS 100% 4.950 3.465 N POLR3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07654 pDONR223 100% 73.2% 73.1% None 0_1ins252;588A>G;689T>A n/a
2 ccsbBroad304_07654 pLX_304 0% 73.2% 73.1% V5 0_1ins252;588A>G;689T>A n/a
3 TRCN0000472647 CCACCGCACTCGCGAAACTTGGGA pLX_317 47.8% 73.2% 73.1% V5 0_1ins252;588A>G;689T>A n/a
Download CSV