Transcript: Human XM_011529144.1

PREDICTED: Homo sapiens destrin, actin depolymerizing factor (DSTN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DSTN (11034)
Length:
2239
CDS:
697..1143

Additional Resources:

NCBI RefSeq record:
XM_011529144.1
NBCI Gene record:
DSTN (11034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116877 GCGCTATTTCAGGCACATCAT pLKO.1 1703 3UTR 100% 4.950 3.960 N DSTN n/a
2 TRCN0000331204 GCGCTATTTCAGGCACATCAT pLKO_005 1703 3UTR 100% 4.950 3.960 N DSTN n/a
3 TRCN0000116879 AGCTCCAAGGATGCAATTAAA pLKO.1 1000 CDS 100% 15.000 9.000 N DSTN n/a
4 TRCN0000299166 AGCTCCAAGGATGCAATTAAA pLKO_005 1000 CDS 100% 15.000 9.000 N DSTN n/a
5 TRCN0000116878 GATCTCAATCGGGCTTGTATT pLKO.1 1069 CDS 100% 13.200 6.600 Y DSTN n/a
6 TRCN0000299215 GATCTCAATCGGGCTTGTATT pLKO_005 1069 CDS 100% 13.200 6.600 Y DSTN n/a
7 TRCN0000116881 GCTTTGTATGATGCAAGCTTT pLKO.1 892 CDS 100% 4.950 2.475 Y DSTN n/a
8 TRCN0000310417 GCTTTGTATGATGCAAGCTTT pLKO_005 892 CDS 100% 4.950 2.475 Y DSTN n/a
9 TRCN0000116880 TGGATCCTTAATTGTAGCCTT pLKO.1 1104 CDS 100% 2.640 1.320 Y DSTN n/a
10 TRCN0000299214 TGGATCCTTAATTGTAGCCTT pLKO_005 1104 CDS 100% 2.640 1.320 Y DSTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02602 pDONR223 100% 89.6% 89.6% None 0_1ins51 n/a
2 ccsbBroad304_02602 pLX_304 0% 89.6% 89.6% V5 0_1ins51 n/a
3 TRCN0000465993 AGCGACTTCACATGTCTCCTGTTA pLX_317 60% 89.6% 89.6% V5 0_1ins51 n/a
Download CSV