Transcript: Human XM_011529151.2

PREDICTED: Homo sapiens heat shock protein family A (Hsp70) member 12B (HSPA12B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSPA12B (116835)
Length:
2528
CDS:
339..1901

Additional Resources:

NCBI RefSeq record:
XM_011529151.2
NBCI Gene record:
HSPA12B (116835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431443 AGTTTGGCGACACCGAAATTA pLKO_005 1813 CDS 100% 15.000 21.000 N HSPA12B n/a
2 TRCN0000427137 CAAGGACTGAACGGGTAAGAG pLKO_005 2131 3UTR 100% 4.950 6.930 N HSPA12B n/a
3 TRCN0000426709 GCAGCGTGAACTTCGTGAAGT pLKO_005 1138 CDS 100% 4.950 6.930 N HSPA12B n/a
4 TRCN0000130497 GCTCTACTTCGAGAAGTTCAA pLKO.1 229 5UTR 100% 4.950 6.930 N HSPA12B n/a
5 TRCN0000130271 CCATCGACTTTCTTTCCAACT pLKO.1 1879 CDS 100% 4.050 2.835 N HSPA12B n/a
6 TRCN0000149737 GAATGTCTTGTGAAGCCATGA pLKO.1 1180 CDS 100% 4.050 2.835 N HSPA12B n/a
7 TRCN0000130294 CCACCCAAATATGACTGTGAA pLKO.1 2448 3UTR 100% 4.950 2.970 N HSPA12B n/a
8 TRCN0000150070 CGAGAAGTTCAAGATGAAGAT pLKO.1 238 5UTR 100% 4.950 2.970 N HSPA12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09435 pDONR223 100% 75.7% 75.8% None 0_1ins498;1383C>T n/a
2 ccsbBroad304_09435 pLX_304 0% 75.7% 75.8% V5 0_1ins498;1383C>T n/a
3 TRCN0000479290 TATCCTCAAGCTTACCCGAACAGT pLX_317 21.2% 75.7% 75.8% V5 0_1ins498;1383C>T n/a
Download CSV