Transcript: Human XM_011529535.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 25 (USP25), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP25 (29761)
Length:
2479
CDS:
448..2151

Additional Resources:

NCBI RefSeq record:
XM_011529535.2
NBCI Gene record:
USP25 (29761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004369 GCGTGAGCTGAGGTATCTATT pLKO.1 1113 CDS 100% 13.200 18.480 N USP25 n/a
2 TRCN0000318645 GCGTGAGCTGAGGTATCTATT pLKO_005 1113 CDS 100% 13.200 18.480 N USP25 n/a
3 TRCN0000004366 GCACTTCTCCTGTTGACGATA pLKO.1 1841 CDS 100% 4.950 6.930 N USP25 n/a
4 TRCN0000318646 GCACTTCTCCTGTTGACGATA pLKO_005 1841 CDS 100% 4.950 6.930 N USP25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11902 pDONR223 100% 64.2% 53.1% None (many diffs) n/a
2 ccsbBroad304_11902 pLX_304 0% 64.2% 53.1% V5 (many diffs) n/a
3 ccsbBroadEn_03088 pDONR223 100% 53.5% 53.4% None 1693_1696delGGTT;1698T>A;1701_1702ins1468 n/a
4 ccsbBroad304_03088 pLX_304 0% 53.5% 53.4% V5 1693_1696delGGTT;1698T>A;1701_1702ins1468 n/a
5 TRCN0000467162 GTTAGACCGGTCGCTGGTCCGGGT pLX_317 14.4% 53.5% 53.4% V5 1693_1696delGGTT;1698T>A;1701_1702ins1468 n/a
Download CSV