Transcript: Human XM_011529588.2

PREDICTED: Homo sapiens zinc finger and BTB domain containing 21 (ZBTB21), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB21 (49854)
Length:
7724
CDS:
460..3660

Additional Resources:

NCBI RefSeq record:
XM_011529588.2
NBCI Gene record:
ZBTB21 (49854)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235883 GACCGAAGATTGCCGTTTAAG pLKO_005 1924 CDS 100% 13.200 18.480 N ZBTB21 n/a
2 TRCN0000019988 CCTTTCTGACTAACATCGTTT pLKO.1 794 CDS 100% 4.950 6.930 N ZBTB21 n/a
3 TRCN0000019985 GCAGCGAATACTTTCAGAGTT pLKO.1 611 CDS 100% 4.950 6.930 N ZBTB21 n/a
4 TRCN0000019984 CGAGAGCAAGTGTGAGTATAA pLKO.1 2757 CDS 100% 13.200 10.560 N ZBTB21 n/a
5 TRCN0000235881 CTATTCACCTTCCATAGATTT pLKO_005 1515 CDS 100% 13.200 10.560 N ZBTB21 n/a
6 TRCN0000235880 CTCAATTTAAGCAGCATATAA pLKO_005 2507 CDS 100% 15.000 10.500 N ZBTB21 n/a
7 TRCN0000235882 GTTTGGAATGGAACGTTTATA pLKO_005 6574 3UTR 100% 15.000 10.500 N ZBTB21 n/a
8 TRCN0000235879 AGTCAAGGCCAATACCAATAA pLKO_005 1002 CDS 100% 13.200 9.240 N ZBTB21 n/a
9 TRCN0000081620 GCAAGTCATCAAGAGGAACTT pLKO.1 2424 CDS 100% 4.950 3.465 N Zbtb21 n/a
10 TRCN0000315915 GCAAGTCATCAAGAGGAACTT pLKO_005 2424 CDS 100% 4.950 3.465 N Zbtb21 n/a
11 TRCN0000019986 CCCAAGAATCAGACACCCTTT pLKO.1 3521 CDS 100% 4.050 2.835 N ZBTB21 n/a
12 TRCN0000019987 CGCTTGTGACATCTGTCACAA pLKO.1 2184 CDS 100% 0.495 0.347 N ZBTB21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08173 pDONR223 100% 99.9% 99.9% None 2881T>C n/a
2 ccsbBroad304_08173 pLX_304 0% 99.9% 99.9% V5 2881T>C n/a
3 TRCN0000476213 ACATGGAGTCGCCGAATTATCACG pLX_317 10.1% 99.9% 99.9% V5 2881T>C n/a
Download CSV