Transcript: Human XM_011529633.2

PREDICTED: Homo sapiens ybeY metalloendoribonuclease (YBEY), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YBEY (54059)
Length:
1824
CDS:
101..655

Additional Resources:

NCBI RefSeq record:
XM_011529633.2
NBCI Gene record:
YBEY (54059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133681 GCAGTAAGATCGAGATTGTAA pLKO.1 159 CDS 100% 5.625 7.875 N YBEY n/a
2 TRCN0000451688 AGAATCTACAGAGATAGAAAT pLKO_005 254 CDS 100% 13.200 9.240 N YBEY n/a
3 TRCN0000133988 CATCTGAAAGCAGGTGAATTT pLKO.1 311 CDS 100% 13.200 9.240 N YBEY n/a
4 TRCN0000135168 CCTAGGAGTGGAGTATATCTT pLKO.1 376 CDS 100% 5.625 3.938 N YBEY n/a
5 TRCN0000135853 CTTCGCAGTAAGATCGAGATT pLKO.1 155 CDS 100% 4.950 3.465 N YBEY n/a
6 TRCN0000134687 GACTACAATTTGGGAGACATT pLKO.1 353 CDS 100% 4.950 3.465 N YBEY n/a
7 TRCN0000133657 GAGTATATCTTCCATCAGTGT pLKO.1 386 CDS 100% 2.640 1.848 N YBEY n/a
8 TRCN0000135131 CCAGATGACTACAATTTGGGA pLKO.1 347 CDS 100% 0.750 0.525 N YBEY n/a
9 TRCN0000134832 CCATTTCATGAGCATCTGAAA pLKO.1 299 CDS 100% 0.495 0.347 N YBEY n/a
10 TRCN0000134387 GATCATCTGTGTTGACAACAA pLKO.1 214 CDS 100% 4.950 2.970 N YBEY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03401 pDONR223 100% 64.7% 61.9% None (many diffs) n/a
2 ccsbBroad304_03401 pLX_304 0% 64.7% 61.9% V5 (many diffs) n/a
3 TRCN0000476740 CGTTTTACCATCTAGCTCGATGCT pLX_317 100% 64.7% 61.9% V5 (many diffs) n/a
Download CSV