Transcript: Human XM_011530108.2

PREDICTED: Homo sapiens tubulin tyrosine ligase like 1 (TTLL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL1 (25809)
Length:
1677
CDS:
383..1540

Additional Resources:

NCBI RefSeq record:
XM_011530108.2
NBCI Gene record:
TTLL1 (25809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048525 CGGCTCTCAGATGACCAAATA pLKO.1 431 CDS 100% 13.200 10.560 N TTLL1 n/a
2 TRCN0000048527 CCGGTTCTGCACAGTGAAATA pLKO.1 925 CDS 100% 13.200 9.240 N TTLL1 n/a
3 TRCN0000048524 CCTCAAGTACAACCTGATTAA pLKO.1 1294 CDS 100% 13.200 9.240 N TTLL1 n/a
4 TRCN0000446018 GGCAAGTGGACAGTGAGTAAC pLKO_005 1040 CDS 100% 10.800 7.560 N TTLL1 n/a
5 TRCN0000048526 GCCGGTGATGAACAATGACAA pLKO.1 1159 CDS 100% 4.950 3.465 N TTLL1 n/a
6 TRCN0000048523 GCCTACGTGATCTCTCTCTAT pLKO.1 797 CDS 100% 4.950 3.465 N TTLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02860 pDONR223 100% 91% 91% None 0_1ins114 n/a
2 ccsbBroad304_02860 pLX_304 0% 91% 91% V5 0_1ins114 n/a
3 TRCN0000472148 TGATGTTCGCCCGTATGGCTTGCC pLX_317 36.6% 91% 91% V5 0_1ins114 n/a
Download CSV