Transcript: Human XM_011530152.2

PREDICTED: Homo sapiens radial spoke head 14 homolog (RSPH14), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSPH14 (27156)
Length:
1522
CDS:
289..1497

Additional Resources:

NCBI RefSeq record:
XM_011530152.2
NBCI Gene record:
RSPH14 (27156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142353 GCAACAGTATGGTGCGCATAA pLKO.1 524 CDS 100% 10.800 15.120 N RSPH14 n/a
2 TRCN0000427093 GCCATGAACATAGGCTGTATG pLKO_005 475 CDS 100% 10.800 15.120 N RSPH14 n/a
3 TRCN0000141741 GCGCTCCTTAATGTCAGCATA pLKO.1 925 CDS 100% 4.950 3.960 N RSPH14 n/a
4 TRCN0000143334 GCTGAAGGATAGCAACAGTAT pLKO.1 513 CDS 100% 4.950 3.465 N RSPH14 n/a
5 TRCN0000143489 GTGTATCTACAAGGCCATGAA pLKO.1 462 CDS 100% 4.950 3.465 N RSPH14 n/a
6 TRCN0000143574 GAACCTGAAAGCTTTGCTGAA pLKO.1 498 CDS 100% 4.050 2.835 N RSPH14 n/a
7 TRCN0000143407 CTGAAAGCTTTGCTGAAGGAT pLKO.1 502 CDS 100% 3.000 2.100 N RSPH14 n/a
8 TRCN0000143575 GATCATCAGCAAAGGTCTGAT pLKO.1 720 CDS 100% 0.495 0.297 N RSPH14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08063 pDONR223 100% 86.4% 68.5% None 148T>C;787_919del;1178_1206del n/a
2 ccsbBroad304_08063 pLX_304 0% 86.4% 68.5% V5 148T>C;787_919del;1178_1206del n/a
3 TRCN0000469586 TATCTCAATTCAATATCCCCTCAT pLX_317 42.9% 86.4% 68.5% V5 148T>C;787_919del;1178_1206del n/a
Download CSV