Transcript: Human XM_011530223.2

PREDICTED: Homo sapiens beta-ureidopropionase 1 (UPB1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UPB1 (51733)
Length:
1452
CDS:
345..1391

Additional Resources:

NCBI RefSeq record:
XM_011530223.2
NBCI Gene record:
UPB1 (51733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119014 CGCGTTCTCTATGGCAAGGAA pLKO.1 423 CDS 100% 3.000 4.200 N UPB1 n/a
2 TRCN0000424150 AGCACTTCCCGAACGAGTTTA pLKO_005 1411 3UTR 100% 13.200 9.240 N UPB1 n/a
3 TRCN0000119012 CAACGAGTCAACTTACTACAT pLKO.1 1040 CDS 100% 4.950 3.465 N UPB1 n/a
4 TRCN0000119015 AGACGCATAAAGGCTATCGTA pLKO.1 636 CDS 100% 3.000 2.100 N UPB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08341 pDONR223 100% 75.7% 71.6% None (many diffs) n/a
2 ccsbBroad304_08341 pLX_304 0% 75.7% 71.6% V5 (many diffs) n/a
3 TRCN0000475558 CTTCCGAGTGTGCTTCCCCACTAG pLX_317 26.7% 75.7% 71.6% V5 (many diffs) n/a
Download CSV