Construct: ORF TRCN0000475558
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004426.1_s317c1
- Derived from:
- ccsbBroadEn_08341
- DNA Barcode:
- CTTCCGAGTGTGCTTCCCCACTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UPB1 (51733)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475558
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51733 | UPB1 | beta-ureidopropionase 1 | NM_016327.3 | 99.9% | 99.7% | 1136C>T |
| 2 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_011530222.2 | 93.3% | 93.1% | 365_445del;1217C>T |
| 3 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_011530224.2 | 77.2% | 77.1% | 365_445del;954_955ins198;1019C>T |
| 4 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_017028825.1 | 76% | 71% | (many diffs) |
| 5 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_011530223.2 | 75.7% | 71.6% | (many diffs) |
| 6 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_017028826.1 | 74.8% | 74.6% | (many diffs) |
| 7 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_011530225.2 | 68.1% | 67.9% | 0_1ins366;770C>T |
| 8 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_017028827.2 | 60.5% | 49.1% | 365_445del;700_701ins170;828_828delAins236 |
| 9 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XM_017028828.1 | 58% | 48.1% | (many diffs) |
| 10 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XR_001755249.1 | 45.5% | (many diffs) | |
| 11 | human | 51733 | UPB1 | beta-ureidopropionase 1 | XR_937867.2 | 24.8% | (many diffs) | |
| 12 | mouse | 103149 | Upb1 | ureidopropionase, beta | NM_133995.4 | 81.9% | 83.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1221
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgggcgct gagtggaagt cgctggagga atgcttggag aagcacctgc 121 cgctccccga cttgcaggaa gtgaagcgcg ttctctatgg caaggaactc aggaagcttg 181 atctgcccag ggaagctttc gaagctgcct ccagagaaga ctttgaactg cagggatatg 241 cctttgaagc agcggaggag cagctgagac gaccccgcat tgtgcacgtg gggctggttc 301 agaacagaat ccccctcccc gcaaatgccc ctgtggcaga acaggtctct gcccttcata 361 gacgcataaa ggctatcgta gaggtggctg caatgtgtgg agtcaacatc atctgtttcc 421 aggaagcatg gactatgccc tttgccttct gtacgagaga gaagcttcct tggacagaat 481 ttgctgagtc agcagaggat gggcccacca ccagattctg tcagaagctg gcgaagaacc 541 atgacatggt ggtggtgtct cccatcctgg aacgagacag cgagcatggg gatgttttgt 601 ggaatacagc cgtggtgatc tccaattccg gagcagtcct gggaaagacc aggaaaaacc 661 acatccccag agtgggtgat ttcaacgagt caacttacta catggaggga aacctgggcc 721 accccgtgtt ccagacgcag ttcggaagga tcgcggtgaa catttgctac gggcggcacc 781 accccctcaa ctggcttatg tacagcatca acggggctga gatcatcttc aacccctcgg 841 ccacgatagg agcactcagc gagtccctgt ggcccatcga ggccagaaac gcagccattg 901 ccaatcactg cttcaccTGC GCCATCAATC GAGTGGGCAC CGAGCACTTC CCGAACGAGT 961 TTACCTCGGG AGATGGAAAG AAAGCTCACC AGGACTTTGG CTACTTTTAT GGCTCGAGCT 1021 ATGTGGCAGC CCCTGACAGC AGCCGGACTC CTGGGCTGTC CCGTAGCCGG GATGGACTGC 1081 TAGTTGCTAA GCTCGACCTA AACCTCTGCC AGCAGGTGAA TGATGTCTGG AACTTCAAGA 1141 TGACGGGCAG GTATGAGATG TACGCACGGG AGCTCGCCGA AGCTGTCAAG TCCAACTACA 1201 GCCTCACCAT CGTGAAAGAG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1261 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1321 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTTC CGAGTGTGCT 1381 TCCCCACTAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt