Transcript: Human XM_011530319.3

PREDICTED: Homo sapiens EF-hand calcium binding domain 6 (EFCAB6), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFCAB6 (64800)
Length:
5449
CDS:
924..5369

Additional Resources:

NCBI RefSeq record:
XM_011530319.3
NBCI Gene record:
EFCAB6 (64800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438240 GCTGCTAAGCGTCGCAGATTT pLKO_005 4961 CDS 100% 13.200 18.480 N EFCAB6 n/a
2 TRCN0000432814 TATAACATGCTACGCTCATAT pLKO_005 2133 CDS 100% 13.200 18.480 N EFCAB6 n/a
3 TRCN0000055539 GCAGTAGATTACAACGTGTTT pLKO.1 1284 CDS 100% 4.950 6.930 N EFCAB6 n/a
4 TRCN0000055541 CGACTTAAAGAGCAACGGGAA pLKO.1 4718 CDS 100% 2.160 3.024 N EFCAB6 n/a
5 TRCN0000055542 CGGCATGATAATGCTATCAAT pLKO.1 3651 CDS 100% 0.563 0.788 N EFCAB6 n/a
6 TRCN0000432207 CTAAACCCGATGGACCGATAA pLKO_005 1855 CDS 100% 10.800 7.560 N EFCAB6 n/a
7 TRCN0000055538 CCACAGAAGAAGTGATTGAAA pLKO.1 2464 CDS 100% 5.625 3.938 N EFCAB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08872 pDONR223 100% 90.9% 90.8% None (many diffs) n/a
2 ccsbBroad304_08872 pLX_304 0% 90.9% 90.8% V5 (many diffs) n/a
3 TRCN0000479272 ACTAAACGCCGGGACTACAACTGT pLX_317 8.5% 90.9% 90.8% V5 (many diffs) n/a
Download CSV