Transcript: Human XM_011530557.2

PREDICTED: Homo sapiens DEP domain containing 5, GATOR1 subcomplex subunit (DEPDC5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DEPDC5 (9681)
Length:
5512
CDS:
210..4994

Additional Resources:

NCBI RefSeq record:
XM_011530557.2
NBCI Gene record:
DEPDC5 (9681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137523 GACCTTCATCTACGGCTTCTA pLKO.1 3929 CDS 100% 4.950 6.930 N DEPDC5 n/a
2 TRCN0000137028 CCAAATCATAGTGCAGCCCAA pLKO.1 2615 CDS 100% 2.160 3.024 N DEPDC5 n/a
3 TRCN0000134778 CCATTGTTCAAGCTCCATAAT pLKO.1 1341 CDS 100% 13.200 10.560 N DEPDC5 n/a
4 TRCN0000135857 CCCTTGACCTAGTGGAATTAA pLKO.1 496 CDS 100% 15.000 10.500 N DEPDC5 n/a
5 TRCN0000136459 CCTTCACCATCTATGGGATAT pLKO.1 5354 3UTR 100% 10.800 7.560 N DEPDC5 n/a
6 TRCN0000135505 GCTTCTTGTTAGTCCCAGTTT pLKO.1 4420 CDS 100% 4.950 3.465 N DEPDC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02226 pDONR223 100% 34.9% 34.8% None 1668_1670delTGTinsGCA;1673_1674insA;1677_4782del n/a
2 ccsbBroad304_02226 pLX_304 0% 34.9% 34.8% V5 1668_1670delTGTinsGCA;1673_1674insA;1677_4782del n/a
3 TRCN0000471584 ACGCCCCGTCACTGCACAAAGTGG pLX_317 23.1% 34.9% 34.8% V5 1668_1670delTGTinsGCA;1673_1674insA;1677_4782del n/a
Download CSV