Transcript: Human XM_011530884.1

PREDICTED: Homo sapiens TSC22 domain family member 3 (TSC22D3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSC22D3 (1831)
Length:
2304
CDS:
404..1006

Additional Resources:

NCBI RefSeq record:
XM_011530884.1
NBCI Gene record:
TSC22D3 (1831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013796 GCGTGAGAACACCCTGTTGAA pLKO.1 874 CDS 100% 4.950 6.930 N TSC22D3 n/a
2 TRCN0000364549 CCATAGACAACAAGATCGAAC pLKO_005 747 CDS 100% 4.050 5.670 N TSC22D3 n/a
3 TRCN0000364625 TGAAGAATCATCTGATGTATG pLKO_005 783 CDS 100% 10.800 7.560 N TSC22D3 n/a
4 TRCN0000013797 GTGAAGAATCATCTGATGTAT pLKO.1 782 CDS 100% 5.625 3.938 N TSC22D3 n/a
5 TRCN0000369187 GAAGTTCCAGTCCTGTCTGAG pLKO_005 922 CDS 100% 4.050 2.835 N TSC22D3 n/a
6 TRCN0000013795 GCCATAGACAACAAGATCGAA pLKO.1 746 CDS 100% 3.000 2.100 N TSC22D3 n/a
7 TRCN0000085746 CCCTGGTGGTTCTGCGGTGTA pLKO.1 985 CDS 100% 0.000 0.000 N Tsc22d3 n/a
8 TRCN0000013793 CCTAGTTCTTTCCAGTTTGTT pLKO.1 1051 3UTR 100% 5.625 3.375 N TSC22D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06126 pDONR223 100% 38.3% 38.5% None 1_369del;600G>C n/a
2 ccsbBroad304_06126 pLX_304 0% 38.3% 38.5% V5 1_369del;600G>C n/a
3 TRCN0000470835 CGCGCGATGTAGTTTTCTGCACTA pLX_317 100% 38.3% 38.5% V5 1_369del;600G>C n/a
Download CSV