Transcript: Human XM_011530946.2

PREDICTED: Homo sapiens LHFPL tetraspan subfamily member 1 (LHFPL1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHFPL1 (340596)
Length:
1374
CDS:
365..928

Additional Resources:

NCBI RefSeq record:
XM_011530946.2
NBCI Gene record:
LHFPL1 (340596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423030 GTACTAAGGATTAGGCCATTT pLKO_005 985 3UTR 100% 10.800 15.120 N LHFPL1 n/a
2 TRCN0000434543 CAGTTCATTCCCAAGTATTTA pLKO_005 1293 3UTR 100% 15.000 10.500 N LHFPL1 n/a
3 TRCN0000143975 CATCAGTTCATTCCCAAGTAT pLKO.1 1290 3UTR 100% 5.625 3.938 N LHFPL1 n/a
4 TRCN0000142469 GAGCTTGACCATTGCCTCAAA pLKO.1 902 CDS 100% 4.950 3.465 N LHFPL1 n/a
5 TRCN0000142134 GCCAGTGTCATTCAGCACATT pLKO.1 484 CDS 100% 4.950 3.465 N LHFPL1 n/a
6 TRCN0000141608 CTTCCTACCTTACTGGCTCTT pLKO.1 445 CDS 100% 4.050 2.835 N LHFPL1 n/a
7 TRCN0000143949 CACACAGTTCATCAGTTCATT pLKO.1 1281 3UTR 100% 5.625 3.375 N LHFPL1 n/a
8 TRCN0000121842 GAGGAAACATTCTCAGACATT pLKO.1 1120 3UTR 100% 4.950 2.970 N LHFPL1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 32 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13602 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13602 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474507 TACTAACTTACGCTAGCGGCTCCT pLX_317 95.2% 100% 100% V5 n/a
4 ccsbBroadEn_05477 pDONR223 100% 85% 85% None 380_381ins99 n/a
5 ccsbBroad304_05477 pLX_304 0% 85% 85% V5 380_381ins99 n/a
6 TRCN0000480663 GATCCGAGCACACTCAAGCAAAAA pLX_317 55% 85% 85% V5 380_381ins99 n/a
Download CSV