Transcript: Human XM_011530955.1

PREDICTED: Homo sapiens XK related X-linked (XKRX), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XKRX (402415)
Length:
2216
CDS:
322..1323

Additional Resources:

NCBI RefSeq record:
XM_011530955.1
NBCI Gene record:
XKRX (402415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000455043 ATCACCATCTGGCGGACATTG pLKO_005 700 CDS 100% 10.800 15.120 N XKRX n/a
2 TRCN0000158107 CCTGGGTAGAGTTGTGCTAAT pLKO.1 567 CDS 100% 10.800 15.120 N XKRX n/a
3 TRCN0000157405 GACAGAGATCTCGTCGACAAA pLKO.1 979 CDS 100% 4.950 6.930 N XKRX n/a
4 TRCN0000153422 GCTATCCAGATCAAGTACGAT pLKO.1 640 CDS 100% 3.000 4.200 N XKRX n/a
5 TRCN0000153971 CACCCGAAAGAAGATGCTAAT pLKO.1 381 CDS 100% 10.800 7.560 N XKRX n/a
6 TRCN0000421813 TGCACCGCAATGCCTACAAAC pLKO_005 461 CDS 100% 10.800 7.560 N XKRX n/a
7 TRCN0000158266 CCCAGGAAACAGTCTGACTAA pLKO.1 1753 3UTR 100% 4.950 3.465 N XKRX n/a
8 TRCN0000158208 CCTCTCACTTAGTGCCTCATT pLKO.1 2066 3UTR 100% 4.950 2.970 N XKRX n/a
9 TRCN0000152682 GCTCTCTAAAGTGACCTTCTA pLKO.1 1611 3UTR 100% 4.950 2.970 N XKRX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10137 pDONR223 100% 72% 72% None 0_1ins387 n/a
2 ccsbBroad304_10137 pLX_304 0% 72% 72% V5 0_1ins387 n/a
3 TRCN0000476356 ACCTAACCGTGAAGTCACCGCACC pLX_317 24.4% 72% 72% V5 0_1ins387 n/a
Download CSV