Transcript: Human XM_011530974.3

PREDICTED: Homo sapiens neuroligin 3 (NLGN3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLGN3 (54413)
Length:
3250
CDS:
615..2810

Additional Resources:

NCBI RefSeq record:
XM_011530974.3
NBCI Gene record:
NLGN3 (54413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438123 GGCGAGGACTTAGCGGATAAT pLKO_005 801 CDS 100% 13.200 18.480 N NLGN3 n/a
2 TRCN0000436445 TCCAGACTTGGGAGCTTTAAA pLKO_005 3205 3UTR 100% 15.000 10.500 N NLGN3 n/a
3 TRCN0000417189 ACCAAGGGTCCGAGATCATTA pLKO_005 2090 CDS 100% 13.200 9.240 N NLGN3 n/a
4 TRCN0000047085 CGTGACTACTCCACTGAATTA pLKO.1 2367 CDS 100% 13.200 9.240 N NLGN3 n/a
5 TRCN0000047083 GCAGACAAAGTGGGCTGTAAT pLKO.1 1266 CDS 100% 13.200 9.240 N NLGN3 n/a
6 TRCN0000438709 GCAGATGAGTCCTCGGTAAAC pLKO_005 3047 3UTR 100% 10.800 7.560 N NLGN3 n/a
7 TRCN0000047084 CGCCAGTTATGGCAATGTCAT pLKO.1 935 CDS 100% 4.950 3.465 N NLGN3 n/a
8 TRCN0000047087 CCTCTACTACCGTAAGGACAA pLKO.1 2447 CDS 100% 4.050 2.835 N NLGN3 n/a
9 TRCN0000031941 GTGGACAATCTGTATGGCTAT pLKO.1 1572 CDS 100% 4.050 2.430 N Nlgn3 n/a
10 TRCN0000031939 CCACTGAATTAAGTGTCACTA pLKO.1 2377 CDS 100% 4.950 2.970 N Nlgn3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2871 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08371 pDONR223 100% 83.6% 83.4% None (many diffs) n/a
2 ccsbBroad304_08371 pLX_304 0% 83.6% 83.4% V5 (many diffs) n/a
3 TRCN0000478917 ATAACAACAGCAGAAGTCTCTGCG pLX_317 12.4% 83.6% 83.4% V5 (many diffs) n/a
Download CSV