Transcript: Human XM_011531045.2

PREDICTED: Homo sapiens LAS1 like ribosome biogenesis factor (LAS1L), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LAS1L (81887)
Length:
2313
CDS:
42..2120

Additional Resources:

NCBI RefSeq record:
XM_011531045.2
NBCI Gene record:
LAS1L (81887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122340 CCGGATTGGATTGTTGACCTT pLKO.1 357 CDS 100% 2.640 3.696 N LAS1L n/a
2 TRCN0000143123 CCATTGGGAAGTCTCCATATA pLKO.1 1486 CDS 100% 13.200 10.560 N LAS1L n/a
3 TRCN0000297153 CCATTGGGAAGTCTCCATATA pLKO_005 1486 CDS 100% 13.200 10.560 N LAS1L n/a
4 TRCN0000121835 GCAGCTTTGCAGATAGAATAT pLKO.1 933 CDS 100% 13.200 9.240 N LAS1L n/a
5 TRCN0000297202 GCAGCTTTGCAGATAGAATAT pLKO_005 933 CDS 100% 13.200 9.240 N LAS1L n/a
6 TRCN0000121557 CCTGAGTCATAAAGAGCTATA pLKO.1 692 CDS 100% 10.800 7.560 N LAS1L n/a
7 TRCN0000297152 CCTGAGTCATAAAGAGCTATA pLKO_005 692 CDS 100% 10.800 7.560 N LAS1L n/a
8 TRCN0000140970 CCATGAGTTGACCCACAAGAA pLKO.1 380 CDS 100% 4.950 3.465 N LAS1L n/a
9 TRCN0000142144 GCTGCTACTTTGTCCTGGATT pLKO.1 430 CDS 100% 4.950 3.465 N LAS1L n/a
10 TRCN0000278522 GCTGCTACTTTGTCCTGGATT pLKO_005 430 CDS 100% 4.950 3.465 N LAS1L n/a
11 TRCN0000142576 GCCCTGAGTCATAAAGAGCTA pLKO.1 690 CDS 100% 2.640 1.584 N LAS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16016 pDONR223 0% 91.9% 91.8% None 233_234ins126;917_967del n/a
2 ccsbBroad304_16016 pLX_304 0% 91.9% 91.8% V5 233_234ins126;917_967del n/a
Download CSV