Transcript: Human XM_011531148.3

PREDICTED: Homo sapiens host cell factor C1 (HCFC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HCFC1 (3054)
Length:
9426
CDS:
1519..7635

Additional Resources:

NCBI RefSeq record:
XM_011531148.3
NBCI Gene record:
HCFC1 (3054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274019 GTAATGGTGACACACTATTTC pLKO_005 6994 CDS 100% 13.200 18.480 N HCFC1 n/a
2 TRCN0000274004 TGTCCCATCAGACGATGATTT pLKO_005 7032 CDS 100% 13.200 18.480 N HCFC1 n/a
3 TRCN0000016265 CCAAAGAAATCTAAGGCCGAT pLKO.1 7606 CDS 100% 2.160 3.024 N HCFC1 n/a
4 TRCN0000273952 GTGTTTCCAGTCACCTAACTT pLKO_005 8094 3UTR 100% 5.625 3.938 N HCFC1 n/a
5 TRCN0000016266 CCCTATCATCACAGTGCACAA pLKO.1 3408 CDS 100% 4.050 2.835 N HCFC1 n/a
6 TRCN0000016267 GCCCGCAATGAGAAGGGCTAT pLKO.1 7480 CDS 100% 1.350 0.945 N HCFC1 n/a
7 TRCN0000274017 GCCCGCAATGAGAAGGGCTAT pLKO_005 7480 CDS 100% 1.350 0.945 N HCFC1 n/a
8 TRCN0000016264 GCAACCACCATCGGAAATAAA pLKO.1 2296 CDS 100% 15.000 9.000 N HCFC1 n/a
9 TRCN0000016263 CCTTTCTCTTTCTCTCTGTTT pLKO.1 7766 3UTR 100% 4.950 2.970 N HCFC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10870 pDONR223 100% 20.9% 20.9% None 1283C>T;1285_6114del n/a
2 ccsbBroad304_10870 pLX_304 0% 20.9% 20.9% V5 1283C>T;1285_6114del n/a
3 TRCN0000478554 CCCATGGCGTGAGTCTAGATGATT pLX_317 24.7% 20.9% 20.9% V5 1283C>T;1285_6114del n/a
Download CSV