Transcript: Human XM_011531216.2

PREDICTED: Homo sapiens G protein-coupled receptor 50 (GPR50), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR50 (9248)
Length:
2639
CDS:
109..1221

Additional Resources:

NCBI RefSeq record:
XM_011531216.2
NBCI Gene record:
GPR50 (9248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011592 CGGGCTCCTCAATGAGAATTT pLKO.1 249 CDS 100% 13.200 18.480 N GPR50 n/a
2 TRCN0000357288 TATGCGGCACCCTATCATATT pLKO_005 300 CDS 100% 13.200 18.480 N GPR50 n/a
3 TRCN0000357290 GATCTTCAGTGTGCGCAATAC pLKO_005 14 5UTR 100% 10.800 15.120 N GPR50 n/a
4 TRCN0000011594 CCGATGAATGTCCGGAATGTT pLKO.1 451 CDS 100% 5.625 3.938 N GPR50 n/a
5 TRCN0000011591 CCTATCGCAAATCTGCCTCTA pLKO.1 551 CDS 100% 4.050 2.835 N GPR50 n/a
6 TRCN0000220816 CCTGCCTCTGTCCATTTCAAA pLKO.1 688 CDS 100% 5.625 3.375 N Gpr50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489319 TCAAAAGATGGGAAATGATATCAA pLX_317 20.8% 59.8% 59.6% V5 (not translated due to prior stop codon) 1_1delAins742;1075A>G n/a
2 TRCN0000488981 ACCATGCCGATACTTCCCGTTTAG pLX_317 13.4% 59.8% 59.5% V5 1_1delAins742;1075A>G;1110_1111insG n/a
Download CSV