Transcript: Human XM_011531460.3

PREDICTED: Homo sapiens ubiquitously transcribed tetratricopeptide repeat containing, Y-linked (UTY), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UTY (7404)
Length:
4019
CDS:
356..3934

Additional Resources:

NCBI RefSeq record:
XM_011531460.3
NBCI Gene record:
UTY (7404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229955 GGCAACTAGCACTGGTATTAA pLKO_005 2551 CDS 100% 15.000 21.000 N UTY n/a
2 TRCN0000108116 GCGAGCAAATAGAGATAATTT pLKO.1 1939 CDS 100% 15.000 12.000 N UTY n/a
3 TRCN0000108117 GCAGTAATTGTATAGCAGGAA pLKO.1 2274 CDS 100% 2.640 1.848 N UTY n/a
4 TRCN0000218022 GGATGCTTTACAGGCATATAT pLKO_005 1351 CDS 100% 15.000 9.000 N UTY n/a
5 TRCN0000229956 TCCACCCACACCTAGTATTTA pLKO_005 3346 CDS 100% 15.000 9.000 N UTY n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3818 CDS 100% 4.950 2.475 Y n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3891 CDS 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3891 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11214 pDONR223 100% 10.9% 6.5% None (many diffs) n/a
2 ccsbBroad304_11214 pLX_304 0% 10.9% 6.5% V5 (many diffs) n/a
3 TRCN0000479140 CGCTCCGGGTGGCCTTACCGTGTT pLX_317 89.4% 10.9% 6.5% V5 (many diffs) n/a
Download CSV