Transcript: Human XM_011531714.2

PREDICTED: Homo sapiens E74 like ETS transcription factor 2 (ELF2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELF2 (1998)
Length:
2387
CDS:
252..1259

Additional Resources:

NCBI RefSeq record:
XM_011531714.2
NBCI Gene record:
ELF2 (1998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013859 GCTTTGAGATACTACTACCAA pLKO.1 276 CDS 100% 3.000 4.200 N ELF2 n/a
2 TRCN0000273913 ATACTTGTCCCAGGTATATTA pLKO_005 142 5UTR 100% 15.000 10.500 N ELF2 n/a
3 TRCN0000304586 ATACTTGTCCCAGGTATATTA pLKO_005 142 5UTR 100% 15.000 10.500 N Elf2 n/a
4 TRCN0000273856 ATGCAGGTGCACCATTAATAA pLKO_005 718 CDS 100% 15.000 10.500 N ELF2 n/a
5 TRCN0000273916 CATTCTGTAAGAGGTTATATA pLKO_005 1568 3UTR 100% 15.000 10.500 N ELF2 n/a
6 TRCN0000013862 ACCTGTTGTAATGACATCATT pLKO.1 659 CDS 100% 5.625 3.938 N ELF2 n/a
7 TRCN0000013858 GCAAGGGAAGTCATCAAGAAA pLKO.1 1317 3UTR 100% 5.625 3.938 N ELF2 n/a
8 TRCN0000013861 GTACACCTGTAATGAGACTAT pLKO.1 988 CDS 100% 4.950 3.465 N ELF2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 30 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 30 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06156 pDONR223 100% 62.7% 62.6% None 0_1ins594;1005A>T n/a
2 ccsbBroad304_06156 pLX_304 0% 62.7% 62.6% V5 0_1ins594;1005A>T n/a
3 TRCN0000471766 CGTTACGCACTCAAGTCTTTGTGC pLX_317 29.2% 62.7% 62.6% V5 0_1ins594;1005A>T n/a
4 ccsbBroadEn_10799 pDONR223 100% 57% 56.5% None 0_1ins507;848_849insA;864_1005del n/a
5 ccsbBroad304_10799 pLX_304 0% 57% 56.5% V5 0_1ins507;848_849insA;864_1005del n/a
6 TRCN0000469930 CCCTGCAGCAGATTCATTATTAGA pLX_317 32.1% 57% 56.5% V5 0_1ins507;848_849insA;864_1005del n/a
Download CSV