Transcript: Human XM_011531771.2

PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PALLD (23022)
Length:
6456
CDS:
289..4422

Additional Resources:

NCBI RefSeq record:
XM_011531771.2
NBCI Gene record:
PALLD (23022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073467 CCGAGGTTAACATACGAAGAA pLKO.1 3262 CDS 100% 4.950 6.930 N PALLD n/a
2 TRCN0000073466 GCTAATTTAATTGAGGAGCTA pLKO.1 1009 CDS 100% 2.640 3.696 N PALLD n/a
3 TRCN0000073463 GCTCTGAATAAAGCAGAAATA pLKO.1 5137 3UTR 100% 13.200 9.240 N PALLD n/a
4 TRCN0000289995 GCTCTGAATAAAGCAGAAATA pLKO_005 5137 3UTR 100% 13.200 9.240 N PALLD n/a
5 TRCN0000296447 AGTTGTACTGGACGGCTAATG pLKO_005 3523 CDS 100% 10.800 7.560 N PALLD n/a
6 TRCN0000073465 GCCCTTCAAATGCAATTCAAT pLKO.1 2284 CDS 100% 5.625 3.938 N PALLD n/a
7 TRCN0000296446 GGAGTAAATGGACTGATTAAC pLKO_005 2344 CDS 100% 13.200 7.920 N PALLD n/a
8 TRCN0000073464 GCCAAGAATGAAGCAGGGATT pLKO.1 4198 CDS 100% 4.050 2.430 N PALLD n/a
9 TRCN0000090755 GCCGGCATCTACACATGTATT pLKO.1 3877 CDS 100% 13.200 18.480 N Palld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02713 pDONR223 100% 70.9% 70.9% None (many diffs) n/a
2 ccsbBroad304_02713 pLX_304 0% 70.9% 70.9% V5 (many diffs) n/a
3 TRCN0000481534 GAATCCATCTCAACTATATTATTT pLX_317 14% 70.9% 70.9% V5 (many diffs) n/a
Download CSV