Transcript: Human XM_011531808.2

PREDICTED: Homo sapiens CCR4-NOT transcription complex subunit 6 like (CNOT6L), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNOT6L (246175)
Length:
8875
CDS:
140..1831

Additional Resources:

NCBI RefSeq record:
XM_011531808.2
NBCI Gene record:
CNOT6L (246175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306054 GAGTAGCTGACAACCATAAAG pLKO_005 1443 CDS 100% 13.200 18.480 N Cnot6l n/a
2 TRCN0000218774 ACAATTACCTTAGTCGCATTC pLKO_005 333 CDS 100% 6.000 4.800 N CNOT6L n/a
3 TRCN0000096565 CCTGGGCATTAAACTGGGAAT pLKO.1 774 CDS 100% 4.050 3.240 N Cnot6l n/a
4 TRCN0000230551 AGTCATTCTGTGACCTATAAA pLKO_005 8059 3UTR 100% 15.000 10.500 N CNOT6L n/a
5 TRCN0000096566 GCAGACAAACAGCTGCTTATA pLKO.1 1208 CDS 100% 13.200 9.240 N Cnot6l n/a
6 TRCN0000052049 GCTGCACCTAAATGACAATTA pLKO.1 319 CDS 100% 13.200 9.240 N CNOT6L n/a
7 TRCN0000230550 TGATATTGCCAAGCTTCATAA pLKO_005 358 CDS 100% 13.200 9.240 N CNOT6L n/a
8 TRCN0000230549 TTGACAGCGCTGCACCTAAAT pLKO_005 311 CDS 100% 13.200 9.240 N CNOT6L n/a
9 TRCN0000219060 AGTACATCACTTTGGTCATTG pLKO_005 284 CDS 100% 10.800 7.560 N CNOT6L n/a
10 TRCN0000052052 GCATTGAAGGAGCGTGGATAT pLKO.1 920 CDS 100% 10.800 7.560 N CNOT6L n/a
11 TRCN0000052048 CCCAGAGTATTCTGATGTGAA pLKO.1 1255 CDS 100% 4.950 3.465 N CNOT6L n/a
12 TRCN0000052051 CGTCAGCATCATTCACGGTTA pLKO.1 693 CDS 100% 4.050 2.835 N CNOT6L n/a
13 TRCN0000052050 GCAGAAGCATACAGTGGAATT pLKO.1 1048 CDS 100% 0.000 0.000 N CNOT6L n/a
14 TRCN0000096568 GTGGAAACAGAGCAATACTTT pLKO.1 884 CDS 100% 5.625 3.938 N Cnot6l n/a
15 TRCN0000325834 GTGGAAACAGAGCAATACTTT pLKO_005 884 CDS 100% 5.625 3.938 N Cnot6l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.