Transcript: Human XM_011531911.1

PREDICTED: Homo sapiens coiled-coil domain containing 158 (CCDC158), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC158 (339965)
Length:
3729
CDS:
245..3598

Additional Resources:

NCBI RefSeq record:
XM_011531911.1
NBCI Gene record:
CCDC158 (339965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263521 CCGGACAGAGCGTGATCAATT pLKO_005 1327 CDS 100% 13.200 18.480 N CCDC158 n/a
2 TRCN0000263522 CATCTATTCGTGGTACAATAA pLKO_005 339 CDS 100% 13.200 10.560 N CCDC158 n/a
3 TRCN0000263518 GATAGGATTGAGCAGTTAATA pLKO_005 1043 CDS 100% 15.000 10.500 N CCDC158 n/a
4 TRCN0000263520 CAGCTTGGGCTCAGCTATTAG pLKO_005 892 CDS 100% 13.200 9.240 N CCDC158 n/a
5 TRCN0000263519 ATAGGGTAAGAGATTGCATTA pLKO_005 3072 CDS 100% 10.800 7.560 N CCDC158 n/a
6 TRCN0000167092 CTTCTCGTTCATTCAATTCTT pLKO.1 3279 CDS 100% 5.625 3.938 N CCDC158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13593 pDONR223 100% 20.1% 18.2% None 604delA;677_3351del n/a
2 ccsbBroad304_13593 pLX_304 0% 20.1% 18.2% V5 604delA;677_3351del n/a
3 TRCN0000475208 ACTTTGATCTAAAATTGAACCTTC pLX_317 52.3% 20.1% 18.2% V5 604delA;677_3351del n/a
Download CSV