Transcript: Human XM_011531915.2

PREDICTED: Homo sapiens coiled-coil domain containing 158 (CCDC158), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC158 (339965)
Length:
3613
CDS:
282..3482

Additional Resources:

NCBI RefSeq record:
XM_011531915.2
NBCI Gene record:
CCDC158 (339965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263521 CCGGACAGAGCGTGATCAATT pLKO_005 1364 CDS 100% 13.200 18.480 N CCDC158 n/a
2 TRCN0000263522 CATCTATTCGTGGTACAATAA pLKO_005 376 CDS 100% 13.200 10.560 N CCDC158 n/a
3 TRCN0000263518 GATAGGATTGAGCAGTTAATA pLKO_005 1080 CDS 100% 15.000 10.500 N CCDC158 n/a
4 TRCN0000263520 CAGCTTGGGCTCAGCTATTAG pLKO_005 929 CDS 100% 13.200 9.240 N CCDC158 n/a
5 TRCN0000263519 ATAGGGTAAGAGATTGCATTA pLKO_005 2956 CDS 100% 10.800 7.560 N CCDC158 n/a
6 TRCN0000167092 CTTCTCGTTCATTCAATTCTT pLKO.1 3163 CDS 100% 5.625 3.938 N CCDC158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13593 pDONR223 100% 21.1% 19% None 604delA;677_3198del n/a
2 ccsbBroad304_13593 pLX_304 0% 21.1% 19% V5 604delA;677_3198del n/a
3 TRCN0000475208 ACTTTGATCTAAAATTGAACCTTC pLX_317 52.3% 21.1% 19% V5 604delA;677_3198del n/a
Download CSV