Transcript: Human XM_011532206.1

PREDICTED: Homo sapiens synuclein alpha (SNCA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNCA (6622)
Length:
755
CDS:
121..633

Additional Resources:

NCBI RefSeq record:
XM_011532206.1
NBCI Gene record:
SNCA (6622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272343 GTTCTCTATGTAGGCTCCAAA pLKO_005 229 CDS 100% 4.950 6.930 N SNCA n/a
2 TRCN0000003736 ACCAAAGAGCAAGTGACAAAT pLKO.1 295 CDS 100% 13.200 9.240 N SNCA n/a
3 TRCN0000272292 ACCAAAGAGCAAGTGACAAAT pLKO_005 295 CDS 100% 13.200 9.240 N SNCA n/a
4 TRCN0000376934 CCAAAGAGCAAGTGACAAATG pLKO_005 296 CDS 100% 10.800 7.560 N Snca n/a
5 TRCN0000320648 AGGACCAGTTGGGCAAGAATG pLKO_005 410 CDS 100% 10.800 15.120 N SNCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01563 pDONR223 100% 71.2% 52.2% None (many diffs) n/a
2 ccsbBroad304_01563 pLX_304 0% 71.2% 52.2% V5 (many diffs) n/a
3 TRCN0000473031 ACAGATCCTCGTATCTCAGAACGT pLX_317 100% 71.2% 52.2% V5 (many diffs) n/a
Download CSV