Transcript: Human XM_011532239.2

PREDICTED: Homo sapiens arylsulfatase family member J (ARSJ), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARSJ (79642)
Length:
3908
CDS:
112..1563

Additional Resources:

NCBI RefSeq record:
XM_011532239.2
NBCI Gene record:
ARSJ (79642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051294 CGGACTTCAACATTCTATCAT pLKO.1 177 CDS 100% 5.625 7.875 N ARSJ n/a
2 TRCN0000051295 GCACAATGAACGGATCACCTT pLKO.1 1203 CDS 100% 2.640 2.112 N ARSJ n/a
3 TRCN0000051293 CCGATCCATTATCAACATAAA pLKO.1 609 CDS 100% 13.200 9.240 N ARSJ n/a
4 TRCN0000051296 CCACCAGAAGAGGATTTGATA pLKO.1 326 CDS 100% 5.625 3.938 N ARSJ n/a
5 TRCN0000051297 GACATTCAACTAGATGGCTAT pLKO.1 946 CDS 100% 4.050 2.835 N ARSJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15985 pDONR223 0% 17.5% 1.2% None 1_943del;1199_1449del n/a
2 ccsbBroad304_15985 pLX_304 0% 17.5% 1.2% V5 1_943del;1199_1449del n/a
3 TRCN0000466145 GTACACCCTACCGTCGCATACGAC pLX_317 100% 17.5% 1.2% V5 1_943del;1199_1449del n/a
Download CSV