Transcript: Human XM_011532268.2

PREDICTED: Homo sapiens glycine receptor alpha 3 (GLRA3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLRA3 (8001)
Length:
2110
CDS:
336..1145

Additional Resources:

NCBI RefSeq record:
XM_011532268.2
NBCI Gene record:
GLRA3 (8001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425840 ACAGGAAAGTTTACGTGTATA pLKO_005 459 CDS 100% 13.200 9.240 N GLRA3 n/a
2 TRCN0000425352 AGCGACAAATGGGATACTATC pLKO_005 499 CDS 100% 10.800 7.560 N GLRA3 n/a
3 TRCN0000060901 GTACACAATGAATGATCTCAT pLKO.1 329 5UTR 100% 4.950 3.465 N GLRA3 n/a
4 TRCN0000060899 CCATGTCTACAAGCAAAGGAT pLKO.1 918 CDS 100% 3.000 2.100 N GLRA3 n/a
5 TRCN0000418195 TTCTACTGGGTTATCTATAAA pLKO_005 1086 CDS 100% 15.000 9.000 N GLRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07194 pDONR223 100% 57.7% 57.9% None (many diffs) n/a
2 ccsbBroad304_07194 pLX_304 0% 57.7% 57.9% V5 (many diffs) n/a
3 TRCN0000473127 ACCTTGACTCCTCTATATGGAAAT pLX_317 28.8% 57.7% 57.9% V5 (many diffs) n/a
Download CSV