Transcript: Human XM_011532308.3

PREDICTED: Homo sapiens sorting nexin 25 (SNX25), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX25 (83891)
Length:
7749
CDS:
246..3194

Additional Resources:

NCBI RefSeq record:
XM_011532308.3
NBCI Gene record:
SNX25 (83891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229922 GTCTCTCAGCTTACGTATAAT pLKO_005 1103 CDS 100% 15.000 21.000 N SNX25 n/a
2 TRCN0000229923 GACCCTAAAGGATAGGTATTA pLKO_005 1979 CDS 100% 13.200 18.480 N SNX25 n/a
3 TRCN0000229925 GGCTTAACTGAGAACCGTATT pLKO_005 3269 3UTR 100% 10.800 15.120 N SNX25 n/a
4 TRCN0000148091 GTGAGAACCTAGGAAGTATTT pLKO.1 3454 3UTR 100% 13.200 10.560 N SNX25 n/a
5 TRCN0000183563 GAGGACTGTGAACATTCTTAT pLKO.1 3541 3UTR 100% 13.200 9.240 N SNX25 n/a
6 TRCN0000147642 GAGGACTTTACTCACTCATTT pLKO.1 929 CDS 100% 13.200 9.240 N SNX25 n/a
7 TRCN0000147517 GATTACATTCTGTCCTGGTAT pLKO.1 780 CDS 100% 4.950 3.465 N SNX25 n/a
8 TRCN0000147986 CCATGTTACTTTGTCATGGTA pLKO.1 2418 CDS 100% 0.300 0.210 N SNX25 n/a
9 TRCN0000379500 CACAATTAGTTGGTGAAATTT pLKO_005 1831 CDS 100% 15.000 9.000 N SNX25 n/a
10 TRCN0000183758 CCACAATTAGTTGGTGAAATT pLKO.1 1830 CDS 100% 13.200 7.920 N SNX25 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7646 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7646 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5340 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7644 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7644 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7644 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5340 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14299 pDONR223 100% 56.5% 56.5% None 1_1278del;1746T>C;2082G>A n/a
2 ccsbBroad304_14299 pLX_304 0% 56.5% 56.5% V5 1_1278del;1746T>C;2082G>A n/a
3 TRCN0000476385 CTGCAAATATAGATCAGTGTTTCA pLX_317 21.7% 56.5% 56.5% V5 1_1278del;1746T>C;2082G>A n/a
Download CSV