Transcript: Human XM_011532411.3

PREDICTED: Homo sapiens nuclear assembly factor 1 ribonucleoprotein (NAF1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAF1 (92345)
Length:
6017
CDS:
814..1692

Additional Resources:

NCBI RefSeq record:
XM_011532411.3
NBCI Gene record:
NAF1 (92345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422154 GTTGAAGAACTCACTATTATT pLKO_005 760 5UTR 100% 15.000 21.000 N NAF1 n/a
2 TRCN0000135721 GACTAACCTACCTCCAGTTAA pLKO.1 858 CDS 100% 13.200 18.480 N NAF1 n/a
3 TRCN0000133774 CGTCTTCTTCCTCTTGTATAT pLKO.1 526 5UTR 100% 13.200 9.240 N NAF1 n/a
4 TRCN0000421333 CATATTATGTGGTAAGGATTT pLKO_005 1727 3UTR 100% 10.800 7.560 N NAF1 n/a
5 TRCN0000134380 GCTGGAAACTCTGAAATTCAA pLKO.1 134 5UTR 100% 5.625 3.938 N NAF1 n/a
6 TRCN0000134443 GATTTCCTTCTCAGAGACAAA pLKO.1 1430 CDS 100% 4.950 3.465 N NAF1 n/a
7 TRCN0000133676 GCAGGAAAGATATTCGAGATA pLKO.1 916 CDS 100% 4.950 3.465 N NAF1 n/a
8 TRCN0000427405 CAAGAGTGATTATGGAGCTAG pLKO_005 1756 3UTR 100% 4.050 2.835 N NAF1 n/a
9 TRCN0000135257 CCAGTTAATGAGGAGACTGTA pLKO.1 871 CDS 100% 4.950 2.970 N NAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09337 pDONR223 100% 59% 58.9% None 0_1ins606;857C>G n/a
2 ccsbBroad304_09337 pLX_304 0% 59% 58.9% V5 0_1ins606;857C>G n/a
3 TRCN0000480972 TTAGACCACTTCGGCAAAACTTTA pLX_317 13.7% 59% 58.9% V5 0_1ins606;857C>G n/a
Download CSV