Transcript: Human XM_011532477.3

PREDICTED: Homo sapiens ssemaphorin 4F (SEMA4F), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA4F (10505)
Length:
6475
CDS:
126..1919

Additional Resources:

NCBI RefSeq record:
XM_011532477.3
NBCI Gene record:
SEMA4F (10505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061130 GACTCATACGAGCGCATTAAA pLKO.1 900 CDS 100% 15.000 21.000 N SEMA4F n/a
2 TRCN0000307634 GACTCATACGAGCGCATTAAA pLKO_005 900 CDS 100% 15.000 21.000 N SEMA4F n/a
3 TRCN0000112273 CAGACAGAACTGTAGGAAGAA pLKO.1 449 CDS 100% 4.950 3.465 N Sema4f n/a
4 TRCN0000112272 CTGTAGGAAGAAAGGCAAGAA pLKO.1 458 CDS 100% 4.950 3.465 N Sema4f n/a
5 TRCN0000061128 CAAGACATAGAGTCAGCAGAT pLKO.1 1776 CDS 100% 4.050 2.835 N SEMA4F n/a
6 TRCN0000291256 CAAGACATAGAGTCAGCAGAT pLKO_005 1776 CDS 100% 4.050 2.835 N SEMA4F n/a
7 TRCN0000061132 GCCCAGAACCTCGCTTCCAAT pLKO.1 245 CDS 100% 1.650 1.155 N SEMA4F n/a
8 TRCN0000291258 GCCCAGAACCTCGCTTCCAAT pLKO_005 245 CDS 100% 1.650 1.155 N SEMA4F n/a
9 TRCN0000061131 CTGAGGTGACACAAGTGAATA pLKO.1 1633 CDS 100% 13.200 7.920 N SEMA4F n/a
10 TRCN0000291257 CTGAGGTGACACAAGTGAATA pLKO_005 1633 CDS 100% 13.200 7.920 N SEMA4F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11510 pDONR223 100% 55% 54% None (many diffs) n/a
2 ccsbBroad304_11510 pLX_304 0% 55% 54% V5 (many diffs) n/a
3 TRCN0000469322 TGGATATCTCGTAGCTAACCACTC pLX_317 25.7% 55% 54% V5 (many diffs) n/a
Download CSV