Transcript: Human XM_011532637.2

PREDICTED: Homo sapiens C-type lectin domain family 4 member F (CLEC4F), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC4F (165530)
Length:
3316
CDS:
589..2688

Additional Resources:

NCBI RefSeq record:
XM_011532637.2
NBCI Gene record:
CLEC4F (165530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432062 ACGCTAATGCTGAGATCTATG pLKO_005 1664 CDS 100% 10.800 15.120 N CLEC4F n/a
2 TRCN0000054320 CCAGTTTGGAAACGGCAAATA pLKO.1 1610 CDS 100% 13.200 10.560 N CLEC4F n/a
3 TRCN0000418420 GATACTCAGATTCAGGTATTC pLKO_005 1984 CDS 100% 10.800 8.640 N CLEC4F n/a
4 TRCN0000054318 GCCCAGATTCAGGTCTTAAAT pLKO.1 2038 CDS 100% 15.000 10.500 N CLEC4F n/a
5 TRCN0000054321 CCCTCCATGTGGTCATTACTT pLKO.1 2258 CDS 100% 5.625 3.938 N CLEC4F n/a
6 TRCN0000054319 CCCAACAATCATCACCACTTT pLKO.1 1180 CDS 100% 4.950 3.465 N CLEC4F n/a
7 TRCN0000054322 CCAGACATTTAAAGGCCACAT pLKO.1 1230 CDS 100% 4.050 2.835 N CLEC4F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13342 pDONR223 100% 79.8% 79.6% None (many diffs) n/a
2 ccsbBroad304_13342 pLX_304 0% 79.8% 79.6% V5 (many diffs) n/a
3 TRCN0000467966 ATCACCATTCCCATCACAGAACAT pLX_317 24.5% 79.8% 79.6% V5 (many diffs) n/a
Download CSV