Transcript: Human XM_011532901.3

PREDICTED: Homo sapiens cysteine rich transmembrane BMP regulator 1 (CRIM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRIM1 (51232)
Length:
5421
CDS:
64..3075

Additional Resources:

NCBI RefSeq record:
XM_011532901.3
NBCI Gene record:
CRIM1 (51232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063862 CCGGGAAACCTGAACATACTA pLKO.1 856 CDS 100% 5.625 7.875 N CRIM1 n/a
2 TRCN0000289391 CCGGGAAACCTGAACATACTA pLKO_005 856 CDS 100% 5.625 7.875 N CRIM1 n/a
3 TRCN0000063859 GCGTATTTAACAATGTGGAAT pLKO.1 1193 CDS 100% 4.950 6.930 N CRIM1 n/a
4 TRCN0000306826 GCGTATTTAACAATGTGGAAT pLKO_005 1193 CDS 100% 4.950 6.930 N CRIM1 n/a
5 TRCN0000063861 CCGTGGATGGTCATCATCATA pLKO.1 2015 CDS 100% 5.625 3.938 N CRIM1 n/a
6 TRCN0000289444 CCGTGGATGGTCATCATCATA pLKO_005 2015 CDS 100% 5.625 3.938 N CRIM1 n/a
7 TRCN0000175393 CCAGGTAGATTACAGAGATAA pLKO.1 2724 CDS 100% 13.200 7.920 N Crim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14144 pDONR223 100% 89.1% 41.4% None (many diffs) n/a
2 ccsbBroad304_14144 pLX_304 0% 89.1% 41.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480541 ACATAGGCCCAGCACTACTATAAC pLX_317 13.5% 89.1% 41.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV