Transcript: Human XM_011533069.2

PREDICTED: Homo sapiens steroid 5 alpha-reductase 2 (SRD5A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRD5A2 (6716)
Length:
5261
CDS:
1009..1551

Additional Resources:

NCBI RefSeq record:
XM_011533069.2
NBCI Gene record:
SRD5A2 (6716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026506 CGTATGTTTCTGGAGCCAATT pLKO.1 1346 CDS 100% 10.800 15.120 N SRD5A2 n/a
2 TRCN0000418326 CTCAATCGAGGGAGGCCTTAT pLKO_005 1087 CDS 100% 10.800 15.120 N SRD5A2 n/a
3 TRCN0000420931 GTGGTGTCTGCTTAGAGTTTA pLKO_005 1699 3UTR 100% 13.200 9.240 N SRD5A2 n/a
4 TRCN0000026553 TCTGATTTACTGTGCTGAATA pLKO.1 1173 CDS 100% 13.200 9.240 N SRD5A2 n/a
5 TRCN0000026582 CCACCATAGGTTCTACCTCAA pLKO.1 1476 CDS 100% 4.050 2.835 N SRD5A2 n/a
6 TRCN0000026548 CCTCAAGATGTTTGAGGACTA pLKO.1 1491 CDS 100% 0.405 0.284 N SRD5A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01590 pDONR223 100% 69% 63.9% None (many diffs) n/a
2 ccsbBroad304_01590 pLX_304 0% 69% 63.9% V5 (many diffs) n/a
3 TRCN0000469055 TCTAGTGGATAAAGTCTAATGCAA pLX_317 39.1% 69% 63.9% V5 (many diffs) n/a
Download CSV